[PDF] Top 20 Glucocorticoid receptor-binding site in the human immunodeficiency virus long terminal repeat.
Has 10000 "Glucocorticoid receptor-binding site in the human immunodeficiency virus long terminal repeat." found on our website. Below are the top 20 most common "Glucocorticoid receptor-binding site in the human immunodeficiency virus long terminal repeat.".
Glucocorticoid receptor-binding site in the human immunodeficiency virus long terminal repeat.
... Chicken ovalbumin upstream region promoter transcription factor binds to a negative regulatory region in the human immunodeficiency virus type I long terminal repeat.. Regulation of HIV-[r] ... See full document
5
The control of human immunodeficiency virus type 1 long terminal repeat promoter activity by retinoic acid
... again site B is able to confer a retinoic acid response to a heterologous promoter in CV1 cells, a monkey kidney cell ...steroid receptor binding region to contain a further 3' half site and 5 ... See full document
171
Interactions of thyroid hormone receptor with the human immunodeficiency virus type 1 (HIV-1) long terminal repeat and the HIV-1 Tat transactivator.
... ARV-2 virus strain (22), in which all three wild-type Sp1 sites [( 2 76)GAGGCG TGGCCTGGGCGGGACTGGGGAGTGGCGA(243)] are mutated [(276) GATATCTGGCCTGTCTAGATCCGTGCACTGGCGT( 2 ...XhoI site followed by the distal ... See full document
10
Targeted Derepression of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat by Pyrrole-Imidazole Polyamides
... ChIP. Nevertheless, the potent ability of specific RCS-binding polyamides to inhibit LSF binding results in an overall de- crease in ChIP. Transfection of cells with a dominant-negative LSF construct, ... See full document
6
Evolution of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat Promoter by Conversion of an NF-κB Enhancer Element into a GABP Binding Site
... Human immunodeficiency virus type 1 (HIV-1) transcription is regulated by the viral Tat protein and cellular factors, of which the concentration and activity may depend on the cell ...Viral ... See full document
10
Characterization of nuclear protein binding to a site in the long terminal repeat of a murine leukemia virus: comparison with the NFAT complex.
... MLPal site, which our mutational studies demonstrated were most critical for T-cell-specific protein binding as described above ...T-cell receptor (TCR) C b 2, V b 2, and d genes, CD8 b -chain gene, ... See full document
7
CDP Binding to Multiple Sites in the Mouse Mammary Tumor Virus Long Terminal Repeat Suppresses Basal and Glucocorticoid-Induced Transcription
... tumor virus (MMTV) is transcribed at high levels in the lactating mammary gland to ensure transmission of virus from the milk of infected female mice to susceptible ...MMTV long terminal ... See full document
12
Molecular and functional interactions of transcription factor USF with the long terminal repeat of human immunodeficiency virus type 1.
... In the context of HIV-1 transcriptional regulation, the stud- ies on the functional role of LTR DNA bending by transcrip- tional factors probably deserve further scrutiny. In fact, it should be considered that, in ... See full document
11
Cooperation between herpes simplex virus type 1-encoded ICP0 and Tat to support transcription of human immunodeficiency virus type 1 long terminal repeat in vivo can occur in the absence of the TAR binding site.
... simian virus 40 and HIV-1 LTR promoters, ...SacI site in the TAR element and the SacI site in the untranslated region of HIV upstream of the initiation codon of the gag ... See full document
10
Identification of c fos responsive elements downstream of TAR in the long terminal repeat of human immunodeficiency virus type 1
... the binding of host cell transcription factors to cis elements in the proviral long terminal repeat ...using human colon epithelial cell lines, demonstrate that the downstream elements ... See full document
14
Genotypic and phenotypic characterization of long terminal repeat sequences from long-term survivors of human immunodeficiency virus type 1 infection.
... Sp1 binding and viral trans-activator Tat ...infectious virus from both PBMC and plasma samples were uniformly unsuc- cessful, raising the possibility that viruses in Pt 5 may be some- what attenuated ... See full document
6
Functional characterization of a complex protein-DNA-binding domain located within the human immunodeficiency virus type 1 long terminal repeat leader region.
... CULLEN* Howard Hughes Medical Institute and Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710 Transcriptional trans activation of the human immunodefic[r] ... See full document
7
Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat.
... LTR transcriptional activity obtained by using NXS mutants in Jurkat cells Spl, TATA, LBP-1, UBP-2 a NRE, Negative regulatory element; IL-2, interleukin-2; IL-2Ra, interleukin-2 receptor[r] ... See full document
9
Probing protein-DNA interactions at the long terminal repeat of human immunodeficiency virus type 1 by in vivo footprinting.
... A human binding site for transcription factor USF/MLTF mimics the negative regulatory element of human immunodeficiency virus type 1.. DNA binding factors that bind to the negative regul[r] ... See full document
5
Longitudinal variation in human immunodeficiency virus long terminal repeat methylation in individuals on suppressive antiretroviral therapy
... Some weaknesses of our study are worth mentioning: as we exclusively sequenced the 5′-LTR and not the complete HIV genome, we were not able to assess the role of 5′-LTR methylation in replication-competent proviruses ... See full document
17
Roles of the auxiliary genes and AP-1 binding site in the long terminal repeat of feline immunodeficiency virus in the early stage of infection in cats.
... AP-1 virus and immunological and histological changes in cats infected with D AP-1 virus would be almost the same as those in cats infected with wild-type virus, based on the results of in vitro ... See full document
9
Repression of human immunodeficiency virus type 1 long terminal repeat-driven gene expression by binding of the virus to its primary cellular receptor, the CD4 molecule.
... virus stocks that were thawed and incubated at 568C for 30 min before their use, while fresh cell-free culture supernatant from UHC-8 cells filtered through a 0.45-mm-pore-size membrane was used as a source of ... See full document
8
A fourth Sp1 site in the human immunodeficiency virus type 1 long terminal repeat is essential for negative-sense transcription.
... negative-sense LTR supported transcription under basal con- ditions and showed a 10-fold induction after PMA stimulation, the negative-sense Sp1 IV mutant (pNS13LTRCAT) showed the same decreased level of transcription ... See full document
8
Identification and characterization of a human herpesvirus 6 gene segment capable of transactivating the human immunodeficiency virus type 1 long terminal repeat in an Sp1 binding site-dependent manner.
... Transactivation of the human immunodeficiency virus promoter by human herpesvirus 6 HHV-6 strains GS and Z-29 in primary human T lymphocytes and identification of transactivating HHV-6 g[r] ... See full document
8
Activation of the human immunodeficiency virus type 1 long terminal repeat by transforming mutants of human p53.
... Since the promoters that are activated by a mutant p53 have specialized transcription factor-binding sites, we tested whether the mutant p53-281G can activate a minimal promoter with a T[r] ... See full document
8
Related subjects