• No results found

[PDF] Top 20 Human Immunodeficiency Virus Type 1 Subtype F Reverse Transcriptase Sequence and Drug Susceptibility

Has 10000 "Human Immunodeficiency Virus Type 1 Subtype F Reverse Transcriptase Sequence and Drug Susceptibility" found on our website. Below are the top 20 most common "Human Immunodeficiency Virus Type 1 Subtype F Reverse Transcriptase Sequence and Drug Susceptibility".

Human Immunodeficiency Virus Type 1 Subtype F Reverse Transcriptase Sequence and Drug Susceptibility

Human Immunodeficiency Virus Type 1 Subtype F Reverse Transcriptase Sequence and Drug Susceptibility

... diminished susceptibility to ...phenotypic susceptibility analysis showed that diversity within group M might affect drug ...in drug susceptibility (22), intra- or inter- subtype ... See full document

5

Worldwide Evaluation of DNA Sequencing Approaches for Identification of Drug Resistance Mutations in the Human Immunodeficiency Virus Type 1 Reverse Transcriptase

Worldwide Evaluation of DNA Sequencing Approaches for Identification of Drug Resistance Mutations in the Human Immunodeficiency Virus Type 1 Reverse Transcriptase

... mutant human immunodefi- ciency virus type 1 (HIV-1) reverse transcriptase was analyzed by automated DNA sequencing in 23 labora- tories ...worldwide. Drug ... See full document

6

Combination of Drugs and Drug-Resistant Reverse Transcriptase Results in a Multiplicative Increase of Human Immunodeficiency Virus Type 1 Mutant Frequencies

Combination of Drugs and Drug-Resistant Reverse Transcriptase Results in a Multiplicative Increase of Human Immunodeficiency Virus Type 1 Mutant Frequencies

... Previously, AZT was found to increase the mutation rates of SNV and MLV (15). Hypotheses proposed to explain these increased mutation rates include (i) AZT alters nucleotide pools, (ii) AZT is incorporated into ... See full document

7

Amino Acid Substitutions at Position 190 of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Increase Susceptibility to Delavirdine and Impair Virus Replication

Amino Acid Substitutions at Position 190 of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Increase Susceptibility to Delavirdine and Impair Virus Replication

... After 4 h, the culture medium was removed and replaced with fresh medium. Aliquots of culture supernatants were harvested at serial time points after in- fection. After 3 to 4 days in culture, 25 ␮l of supernatant from ... See full document

12

Mutations in the Thumb Allow Human Immunodeficiency Virus Type 1 Reverse Transcriptase To Be Cleaved by Protease in Virions

Mutations in the Thumb Allow Human Immunodeficiency Virus Type 1 Reverse Transcriptase To Be Cleaved by Protease in Virions

... the sequence of WT RT shows that there are a number of sites where PR might be expected to cleave if it had access (7, 27); moreover, the mutations in the thumb that increased the susceptibility of RT to PR ... See full document

9

Influence of Reverse Transcriptase Variants, Drugs, and Vpr on Human Immunodeficiency Virus Type 1 Mutant Frequencies

Influence of Reverse Transcriptase Variants, Drugs, and Vpr on Human Immunodeficiency Virus Type 1 Mutant Frequencies

... stomatitis virus G protein, and 10 ␮g of pAS1B-Vpr (wt or ...FIG. 1. Assay system used to analyze HIV-1 mutant frequencies in vivo during one round of HIV-1 replication with the lacZ gene as a ... See full document

10

Selective Excision of AZTMP by Drug-Resistant Human Immunodeficiency Virus Reverse Transcriptase

Selective Excision of AZTMP by Drug-Resistant Human Immunodeficiency Virus Reverse Transcriptase

... Mutant characterizations. We tested RTs containing the simple AZT resistance mutation T215Y and the combination of AZT resistance mutations M41L, D67N, K70R, T215Y, and K219Q (designated AZT-21) against wild-type ... See full document

11

Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation.

Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation.

... Lys70Arg virus replicated slightly more efficiently than WT virus in three independent assays of ...in drug-free medium, the entire RT gene (1.7 kb) was amplified from 1 m g of cellular ... See full document

7

Hypersusceptibility to Substrate Analogs Conferred by Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase

Hypersusceptibility to Substrate Analogs Conferred by Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase

... all reverse transcriptases and RNA-dependent viral polymerases (Fig. 1) (4, 21, ...(Fig. 1). Although a few mutations in HIV-1 RT motif B have been shown to confer drug resistance (25, ... See full document

10

Involvement of Novel Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutations in the Regulation of Resistance to Nucleoside Inhibitors

Involvement of Novel Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutations in the Regulation of Resistance to Nucleoside Inhibitors

... chain-terminating NRTI (23). Overall, our data support the idea that H208Y may play a role in mechanisms that regulate NRTI resistance, presumably by promoting the primer rescue. Interestingly, our covariation analysis ... See full document

13

In Vitro Evolution of the Human Immunodeficiency Virus Type 1 Gag Protease Region and Maintenance of Reverse Transcriptase Resistance following Prolonged Drug Exposure

In Vitro Evolution of the Human Immunodeficiency Virus Type 1 Gag Protease Region and Maintenance of Reverse Transcriptase Resistance following Prolonged Drug Exposure

... affect drug binding they could contribute to cross-resistance to all ...tant virus displayed in vitro a reduced phenotypic susceptibility to the other two ... See full document

6

Human Immunodeficiency Virus type 1 reverse transcriptase exists as post translationally modified forms in virions and cells

Human Immunodeficiency Virus type 1 reverse transcriptase exists as post translationally modified forms in virions and cells

... between virus producer cells, viri- ons and newly infected cells, although the minor RT iso- forms became more abundant following ...their susceptibility to ...ing reverse transcription in newly ... See full document

12

Effects of Amino Acid Substitutions at Position 115 on the Fidelity of Human Immunodeficiency Virus Type 1 Reverse Transcriptase

Effects of Amino Acid Substitutions at Position 115 on the Fidelity of Human Immunodeficiency Virus Type 1 Reverse Transcriptase

... of 1 volume of phenol-chloroform, followed by isopropanol precipitation and a 70% ethanol ...recognition sequence, a band approximately 300 bp in size was visible in the ... See full document

7

Resistance to Nucleoside Analog Reverse Transcriptase Inhibitors Mediated by Human Immunodeficiency Virus Type 1 p6 Protein

Resistance to Nucleoside Analog Reverse Transcriptase Inhibitors Mediated by Human Immunodeficiency Virus Type 1 p6 Protein

... the susceptibility phenotype to RT in- hibitors used a standardized recombinant virus susceptibility ...in drug susceptibility for four indepen- dent clones carrying an APP/SPT ... See full document

10

HuR interacts with human immunodeficiency virus type 1 reverse transcriptase, and modulates reverse transcription in infected cells

HuR interacts with human immunodeficiency virus type 1 reverse transcriptase, and modulates reverse transcription in infected cells

... mRNA sequence, we demonstrated that HuR expression was required for an optimal HIV-1 replication cycle and for both the early and late steps of reverse transcription, in ...the reverse ... See full document

14

Genetic Diversity of Protease and Reverse Transcriptase Sequences in Non Subtype B Human Immunodeficiency Virus Type 1 Strains: Evidence of Many Minor Drug Resistance Mutations in Treatment Naive Patients

Genetic Diversity of Protease and Reverse Transcriptase Sequences in Non Subtype B Human Immunodeficiency Virus Type 1 Strains: Evidence of Many Minor Drug Resistance Mutations in Treatment Naive Patients

... Genetic characterization and phylogenetic analysis of HIV-1 isolates from different geographic localities have revealed that HIV-1 can be divided into at least three distinctive groups, designated M ... See full document

7

Comparison of Sequencing by Hybridization and Cycle Sequencing for Genotyping of Human Immunodeficiency Virus Type 1 Reverse Transcriptase

Comparison of Sequencing by Hybridization and Cycle Sequencing for Genotyping of Human Immunodeficiency Virus Type 1 Reverse Transcriptase

... codons 1 to 242 was sequenced by fluoresceinated primer extension (ThermoSequenase Fluorescent Labeled Primer Cycle Sequencing Kit; Amersham Life Science, Buckinghamshire, En- gland), followed by gel ... See full document

7

Cross-Linking of the Fingers Subdomain of Human Immunodeficiency Virus Type 1 Reverse Transcriptase to Template-Primer

Cross-Linking of the Fingers Subdomain of Human Immunodeficiency Virus Type 1 Reverse Transcriptase to Template-Primer

... correct sequence for the 5⬘ end of the R region (5⬘-TAC GCCAAGCTACGTAATACGACTCACTATAGGTCTCTCTGGTTAGACC AGATCTGAGCCTGGGA-3⬘), and a second oligomer containing the primer binding site (PBS) sequence ... See full document

11

High Sequence Conservation of Human Immunodeficiency Virus Type 1 Reverse Transcriptase under Drug Pressure despite the Continuous Appearance of Mutations

High Sequence Conservation of Human Immunodeficiency Virus Type 1 Reverse Transcriptase under Drug Pressure despite the Continuous Appearance of Mutations

... of sequence conservation in human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) in vivo, the first 320 amino acids of RT obtained from ... See full document

12

Effect of the Human Immunodeficiency Virus Type 1 Reverse Transcriptase Polymorphism Leu-214 on Replication Capacity and Drug Susceptibility

Effect of the Human Immunodeficiency Virus Type 1 Reverse Transcriptase Polymorphism Leu-214 on Replication Capacity and Drug Susceptibility

... Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) is responsible for the conversion of the viral single-stranded RNA genome into ... See full document

6

Show all 10000 documents...