• No results found

[PDF] Top 20 Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2.

Has 10000 "Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2." found on our website. Below are the top 20 most common "Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2.".

Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2.

Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2.

... An analysis of transcription factor binding sites in vitro revealed that cellular factor Spl bound to the direct repeat sequence of the HSV-2 promoter and that cellular factor USF bound [r] ... See full document

9

The nucleotide sequence, 5' end, promoter domain, and kinetics of expression of the gene encoding the herpes simplex virus type 2 latency-associated transcript.

The nucleotide sequence, 5' end, promoter domain, and kinetics of expression of the gene encoding the herpes simplex virus type 2 latency-associated transcript.

... The 5619 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest The sequence of the herpes simplex virus type 2 HSV-2 latency-associated transcript LAT region resembles that o[r] ... See full document

5

Characterization of a pseudorabies virus glycoprotein gene with homology to herpes simplex virus type 1 and type 2 glycoprotein C.

Characterization of a pseudorabies virus glycoprotein gene with homology to herpes simplex virus type 1 and type 2 glycoprotein C.

... Anatomy of the herpes simplex virus type 1 strain F glycoprotein B gene: primary sequence and predicted protein structure of the wild type and of monoclonal antibody-resistant mutants.. [r] ... See full document

9

Characterization of the gene encoding herpes simplex virus type 2 glycoprotein C and comparison with the type 1 counterpart.

Characterization of the gene encoding herpes simplex virus type 2 glycoprotein C and comparison with the type 1 counterpart.

... To obtain the complete nucleotide sequence of the region of the HSV-2 genome encoding gC, the protein encoded by the smaller 3'coterminal message, and the upstream and downstream regulat[r] ... See full document

9

Structure and expression of the herpes simplex virus type 2 glycoprotein gB gene.

Structure and expression of the herpes simplex virus type 2 glycoprotein gB gene.

... Anatomy of the herpes simplex virus type 1 strain F glycoprotein B gene: primary sequence and predicted protein structure of the wild type and of monoclonal antibody-resistant mutants.. [r] ... See full document

10

Disulfide bonds of herpes simplex virus type 2 glycoprotein gB.

Disulfide bonds of herpes simplex virus type 2 glycoprotein gB.

... acid sequence (45) plus the sequence Phe-Asp-Leu-Asp-Lys added by an in-frame fusion at the C ter- minus of the truncated gene with a polylinker in the expression ...and 2% ...anti-HSV ... See full document

9

Identification and Characterization of the UL56 Gene Product of Herpes Simplex Virus Type 2

Identification and Characterization of the UL56 Gene Product of Herpes Simplex Virus Type 2

... The UL56 protein was located in the Golgi apparatus as well as in the cytoplasmic vesicles of infected and transfected cells. The results of deletion mutant protein analysis are summarized as follows. (i) The C-terminal ... See full document

11

Characterization of Herpes Simplex Virus 2 Primary MicroRNA Transcript Regulation

Characterization of Herpes Simplex Virus 2 Primary MicroRNA Transcript Regulation

... and Infectious Disease, Bethesda, MD) (2). pCR432- 499 containing HSV-2 ICP34.5 exon 1 sequences was cloned using oST432 (GAGCCCAGCCGCCCGCCATGT) and oST499 (TGTTCGCC CACTCTGCGTCGTCGT). pFlag-miRIII, ... See full document

12

Temporal Regulation of Herpes Simplex Virus Type 2 VP22 Expression and Phosphorylation

Temporal Regulation of Herpes Simplex Virus Type 2 VP22 Expression and Phosphorylation

... The function of this subvirion structure appears to be twofold: to link the capsid of the newly forming viral particle with the envelope and to introduce regulatory proteins into a newly infected ...of ... See full document

9

Herpes Simplex Virus Type 2 Vaccines: New Ground for Optimism?

Herpes Simplex Virus Type 2 Vaccines: New Ground for Optimism?

... Herpes simplex virus type 2 (HSV-2) is the primary cause of genital herpes, a common sexually transmitted disease with at least 40 to 60 million infected individuals in ... See full document

9

Nucleotide sequence of the herpes simplex virus type 2 thymidine kinase gene.

Nucleotide sequence of the herpes simplex virus type 2 thymidine kinase gene.

... GALLOWAY* Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 We have determined the complete nucleotide sequence of the thymidine kinase gene of herpes simplex virus HSV t[r] ... See full document

6

The Genome Sequence of Herpes Simplex Virus Type 2

The Genome Sequence of Herpes Simplex Virus Type 2

... coding sequence of another gene, we noted above that most of the HSV-1 cases have equivalents in the HSV-2 sequence ...UL26.5 gene is presently exceptional in this class in that an ... See full document

12

ICP0 Gene Expression Is a Herpes Simplex Virus Type 1 Apoptotic Trigger

ICP0 Gene Expression Is a Herpes Simplex Virus Type 1 Apoptotic Trigger

... ICP27 gene and cannot produce late viral proteins (59), also results in PARP and caspase-3 cleavage ...recombinant virus devoid of all IE genes but expressing GFP from a heterologous promoter (53), yields ... See full document

12

Herpes simplex virus type 2 inhibition of Fas ligand expression.

Herpes simplex virus type 2 inhibition of Fas ligand expression.

... Flow-cytometric analysis. Isolated human PBMC were processed for flow- cytometric analysis of surface markers as previously described (35). To assess Fas ligand surface expression, we used a biotinylated mouse monoclonal ... See full document

5

Divergence and Recombination of Clinical Herpes Simplex Virus Type 2 Isolates

Divergence and Recombination of Clinical Herpes Simplex Virus Type 2 Isolates

... showed a star-like topology, an appearance that remained when the recombinant candidates were excluded from analysis. In an additional analysis, the gap regions in the sequence alignment were compared to the ... See full document

10

Synthesis and processing of glycoprotein gG of herpes simplex virus type 2.

Synthesis and processing of glycoprotein gG of herpes simplex virus type 2.

... Endo F converted the 74K peptide present in the monensin-treated cells into a 66K peptide, while the 110K to 116K peptide was only partially susceptible, as faster-migrating, diffused-re[r] ... See full document

8

Brainstem Involvement in Neonatal Herpes Simplex Virus Type 2 Encephalitis

Brainstem Involvement in Neonatal Herpes Simplex Virus Type 2 Encephalitis

... At 38 days of age, the infant was discharged from the hospital on full feeds and oral suppressive acyclovir ther- apy. On examination she remained slightly hypotonic and hyperreflexic. At follow-up (9 months of age), she ... See full document

7

Herpes Simplex Virus 1 and 2

Herpes Simplex Virus 1 and 2

... of herpes simplex infection depends on the age and immune status of the host, the anatomic site of involvement, and the antigenic virus ...Primary herpes simplex virus HSV–1 and ... See full document

11

Dichotomy of Glycoprotein G Gene in Herpes Simplex Virus Type 1 Isolates

Dichotomy of Glycoprotein G Gene in Herpes Simplex Virus Type 1 Isolates

... the type-specific gG-1 ELISA, of which 7 sera were derived from patients harboring MAb-reactive isolates and 3 sera were derived from patients carrying MAb-unreactive ...the type-common HSV test, which ... See full document

7

Analysis of the herpes simplex virus type 1 OriS sequence: mapping of functional domains.

Analysis of the herpes simplex virus type 1 OriS sequence: mapping of functional domains.

... Analysis of origin sequences in herpes simplex virus type 2 HSV-2 has shown that deletion of part of a sequence corresponding to site III in HSV-1 resulted in a dramatic loss in DNA repl[r] ... See full document

11

Show all 10000 documents...