[PDF] Top 20 Sequence, function, and regulation of the Vmw65 gene of herpes simplex virus type 2.

... An analysis of transcription factor binding sites in vitro revealed that cellular factor Spl bound to the direct repeat sequence of the HSV-2 promoter and that cellular factor USF bound [r] ... See full document

... The 5619 Downloaded from http://jvi.asm.org/ on November 10, 2019 by guest The sequence of the herpes simplex virus type 2 HSV-2 latency-associated transcript LAT region resembles that o[r] ... See full document

... Anatomy of the herpes simplex virus type 1 strain F glycoprotein B gene: primary sequence and predicted protein structure of the wild type and of monoclonal antibody-resistant mutants.. [r] ... See full document

... To obtain the complete nucleotide sequence of the region of the HSV-2 genome encoding gC, the protein encoded by the smaller 3'coterminal message, and the upstream and downstream regulat[r] ... See full document

... Anatomy of the herpes simplex virus type 1 strain F glycoprotein B gene: primary sequence and predicted protein structure of the wild type and of monoclonal antibody-resistant mutants.. [r] ... See full document

... acid sequence (45) plus the sequence Phe-Asp-Leu-Asp-Lys added by an in-frame fusion at the C ter- minus of the truncated gene with a polylinker in the expression ...and 2% ...anti-HSV ... See full document

... The UL56 protein was located in the Golgi apparatus as well as in the cytoplasmic vesicles of infected and transfected cells. The results of deletion mutant protein analysis are summarized as follows. (i) The C-terminal ... See full document

... and Infectious Disease, Bethesda, MD) (2). pCR432- 499 containing HSV-2 ICP34.5 exon 1 sequences was cloned using oST432 (GAGCCCAGCCGCCCGCCATGT) and oST499 (TGTTCGCC CACTCTGCGTCGTCGT). pFlag-miRIII, ... See full document

... The function of this subvirion structure appears to be twofold: to link the capsid of the newly forming viral particle with the envelope and to introduce regulatory proteins into a newly infected ...of ... See full document

... Herpes simplex virus type 2 (HSV-2) is the primary cause of genital herpes, a common sexually transmitted disease with at least 40 to 60 million infected individuals in ... See full document

... GALLOWAY* Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 We have determined the complete nucleotide sequence of the thymidine kinase gene of herpes simplex virus HSV t[r] ... See full document

... coding sequence of another gene, we noted above that most of the HSV-1 cases have equivalents in the HSV-2 sequence ...UL26.5 gene is presently exceptional in this class in that an ... See full document

... ICP27 gene and cannot produce late viral proteins (59), also results in PARP and caspase-3 cleavage ...recombinant virus devoid of all IE genes but expressing GFP from a heterologous promoter (53), yields ... See full document

... Flow-cytometric analysis. Isolated human PBMC were processed for flow- cytometric analysis of surface markers as previously described (35). To assess Fas ligand surface expression, we used a biotinylated mouse monoclonal ... See full document

... showed a star-like topology, an appearance that remained when the recombinant candidates were excluded from analysis. In an additional analysis, the gap regions in the sequence alignment were compared to the ... See full document

... Endo F converted the 74K peptide present in the monensin-treated cells into a 66K peptide, while the 110K to 116K peptide was only partially susceptible, as faster-migrating, diffused-re[r] ... See full document

... At 38 days of age, the infant was discharged from the hospital on full feeds and oral suppressive acyclovir ther- apy. On examination she remained slightly hypotonic and hyperreflexic. At follow-up (9 months of age), she ... See full document

... of herpes simplex infection depends on the age and immune status of the host, the anatomic site of involvement, and the antigenic virus ...Primary herpes simplex virus HSV–1 and ... See full document

... the type-specific gG-1 ELISA, of which 7 sera were derived from patients harboring MAb-reactive isolates and 3 sera were derived from patients carrying MAb-unreactive ...the type-common HSV test, which ... See full document

... Analysis of origin sequences in herpes simplex virus type 2 HSV-2 has shown that deletion of part of a sequence corresponding to site III in HSV-1 resulted in a dramatic loss in DNA repl[r] ... See full document